View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10855A_low_567 (Length: 207)
Name: NF10855A_low_567
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10855A_low_567 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 21 - 177
Target Start/End: Complemental strand, 36930715 - 36930559
Alignment:
| Q |
21 |
ggttgctccacaccacacagctattgttgtaccttgttaatgttgttttccgtgattcagccatgcacgcattgaaggtccaggcatagcagctatccca |
120 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36930715 |
ggttgccccacaccacacagctattgttgtaccttgttaatgttgttttccgtcattcagccatgcacgcattgaaggtccaggcatagcagctatccca |
36930616 |
T |
 |
| Q |
121 |
ttcttatgaaattattttgatgtgaaataatatgttattcgatttttatatgtattt |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36930615 |
ttcttatgaaattattttgatgtgaaataatatgttattcgatttttatatgtattt |
36930559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University