View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10855A_low_577 (Length: 204)
Name: NF10855A_low_577
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10855A_low_577 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 32 - 204
Target Start/End: Complemental strand, 19190283 - 19190111
Alignment:
| Q |
32 |
ataaccacagttagatcggttatcaagaccgtaaccaccacctgtagtacccccaccataacgtccataaccaccctcatgatacttattatccttattt |
131 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
19190283 |
ataaccactgttagatcggttatcaagaccgtaaccaccacctgtagtaccaccaccataacgtccataaccactctcatgatacttattatccttattt |
19190184 |
T |
 |
| Q |
132 |
ccataataaccaccatttccaccaaacccaccaccagaataaccattttttcgtccggtaggaacaccggagg |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
19190183 |
ccataataaccaccatttccaccaaacccaccaccagaataacccttttttcgtccggtaggaacaccggagg |
19190111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University