View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10855A_low_66 (Length: 398)
Name: NF10855A_low_66
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10855A_low_66 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 301; Significance: 1e-169; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 11 - 323
Target Start/End: Original strand, 45481345 - 45481657
Alignment:
| Q |
11 |
agaatatgtgctggtatgagtcttggtcttaggatggttcaacttcttacagcaacgttggctcatgcatatgattgggagttggagaatggtgtaagtc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45481345 |
agaatatgtgctggtatgagtcttggtcttaggatggttcaacttcttacagcaacgttggctcatgcatatgattgggagttggagaatggtgtaagtc |
45481444 |
T |
 |
| Q |
111 |
cagaaaagcttaatatggatgaagcatatgggctcaccttacagagagcagtgcctattttagcccatcctcgtccaaggctttcaccacatttgtactt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
45481445 |
cagaaaagcttaatatggatgaagcatatgggctcaccttacagagagcagtgcctattttagcccatcctcgtccaaggctttcacctcatttgtactt |
45481544 |
T |
 |
| Q |
211 |
gtaatcatcatcttttcgagtttggcttaatgccccttgtcttcatccaatcatcattctattattaaaattgtggatactctcaactttttaataaagc |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45481545 |
gtaatcatcatcttttcgagtttggcttaatgccccttgccttcatccaatcatcgttctattattaaaattgtggatactctcaactttttaataaagc |
45481644 |
T |
 |
| Q |
311 |
aagaaaagtttac |
323 |
Q |
| |
|
||||||||||||| |
|
|
| T |
45481645 |
aagaaaagtttac |
45481657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 361 - 398
Target Start/End: Original strand, 45481653 - 45481690
Alignment:
| Q |
361 |
tttacattacattcaagtttgcttgtaaactatgaatg |
398 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45481653 |
tttacattacattcaagtttgcttgtaaactattaatg |
45481690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University