View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10855_high_5 (Length: 236)
Name: NF10855_high_5
Description: NF10855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10855_high_5 |
 | |
|
| [»] scaffold0100 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0100 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: scaffold0100
Description:
Target: scaffold0100; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 50238 - 50459
Alignment:
| Q |
1 |
tctcgcgtttgatttcagcatcaatcacactcctacacttgcttgctctgtgagcatagcgcaagcttcgcgagcttgaggttgttgacaaacatgatgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50238 |
tctcgcgtttgatttcagcatcaatcacactcctacacttgcttgttctgttagcatagcgcaagcttcgcgagcttgaggttgttgacaaacatgatgt |
50337 |
T |
|
| Q |
101 |
cgcttcgccggaaaatgaagtcggtgaaaccttcaccgtcgtctcggatttcactttccggtcgccggagcaggaagaagatgtccacactacctttgat |
200 |
Q |
| |
|
||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
50338 |
cgcctcgccggaaaatgaagtcggtgaaaccttcgccgtcgtctcggatttcactttccggtcgccggagcaggaagaggatgtccacactacctttgat |
50437 |
T |
|
| Q |
201 |
cgcgatttcctcgaaatctttc |
222 |
Q |
| |
|
||||||||||||| |||||||| |
|
|
| T |
50438 |
cgcgatttcctcgcaatctttc |
50459 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University