View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10855_low_13 (Length: 225)
Name: NF10855_low_13
Description: NF10855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10855_low_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 16 - 179
Target Start/End: Original strand, 28268844 - 28269007
Alignment:
| Q |
16 |
gagcagagaacaacaagatcagctgagggaggcttctatgtcacttagtgacaaacaaatgcaatcatatattctttatggtggtatgttacttttttat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28268844 |
gagcagagaacaacaagatcagctgagggaggcttctatgtcacttagtgacaaacaaatgcaatcatatattctttatggtggtatgttacttttttat |
28268943 |
T |
|
| Q |
116 |
tggaaattagctatggcgttttattaatattaacttaagcaatacaaagtgaaatatgaccaaa |
179 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28268944 |
tggaaattagctatgacgttttattaatattaacttaagcaatacaaagtgaaatatgaccaaa |
28269007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University