View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10855_low_14 (Length: 216)
Name: NF10855_low_14
Description: NF10855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10855_low_14 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 89; Significance: 4e-43; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 124 - 216
Target Start/End: Complemental strand, 9720989 - 9720897
Alignment:
| Q |
124 |
ggtatgatttgggttatgctggtagattcttttaatgcttgaaactatagttatagaaagttttgttgtattttgttatagaaatttctattt |
216 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9720989 |
ggtatgatttgggttatgctggcagattcttttaatgcttgaaactatagttatagaaagttttgttgtattttgttatagaaatttctattt |
9720897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 1 - 65
Target Start/End: Complemental strand, 9721112 - 9721048
Alignment:
| Q |
1 |
gaagataaaacattatggtagctttgataatccatttcatgccaagtctcttgtttgggtaaatc |
65 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9721112 |
gaagataaaacattatggtagctttgataatccatttcatgtcaagtctcttgtttgggtaaatc |
9721048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University