View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10858_high_21 (Length: 220)
Name: NF10858_high_21
Description: NF10858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10858_high_21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 1 - 125
Target Start/End: Original strand, 45242978 - 45243102
Alignment:
| Q |
1 |
cgtggttttcacatcatcaattggtgcagtctatatggaccccaataggagtgttgatgtagaggttgatgagtcttgctggagtgatttggagttttgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45242978 |
cgtggttttcacatcatcaattggtgcagtctatatggaccccaataggagtgttgatgtagaggttgatgagtcttgctggagtgatttggagttttgc |
45243077 |
T |
|
| Q |
101 |
aagaaaaccaaggtcaataataata |
125 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
45243078 |
aagaaaaccaaggtcaataataata |
45243102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 159 - 201
Target Start/End: Original strand, 45243141 - 45243183
Alignment:
| Q |
159 |
gttgattgatttgaaattttgttgatattgtagaattggtatt |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45243141 |
gttgattgatttgaaattttgttgatattgtagaattggtatt |
45243183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University