View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10858_high_8 (Length: 337)

Name: NF10858_high_8
Description: NF10858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10858_high_8
NF10858_high_8
[»] chr2 (3 HSPs)
chr2 (93-174)||(9723271-9723353)
chr2 (266-329)||(9723072-9723135)
chr2 (171-236)||(9723138-9723203)


Alignment Details
Target: chr2 (Bit Score: 75; Significance: 2e-34; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 93 - 174
Target Start/End: Complemental strand, 9723353 - 9723271
Alignment:
93 tactttttgcattaattccaaaccaccatccataatgtt-cactgtaccctcaacaacaaattaaattgcaacaatatatcta 174  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
9723353 tactttttgcattaattccaaaccaccatccataatgtttcactgtaccctcaacaacaaattaaattgcaacaatatatcta 9723271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 266 - 329
Target Start/End: Complemental strand, 9723135 - 9723072
Alignment:
266 attcttaagacagaagtttcctgctcattatgatcttatctgactcgagagattagtctctgct 329  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
9723135 attcttaagacagaagttttctgctcattatgatcttatctgactcgagagattagtctctgct 9723072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 171 - 236
Target Start/End: Complemental strand, 9723203 - 9723138
Alignment:
171 tctaaccaaaagtatttagatgagatgactcggatttcttttagtttaatcataggtcttgagttc 236  Q
    |||| |||| ||||||||||||||||||||| |||||||||  ||||||| |||| | ||||||||    
9723203 tctagccaagagtatttagatgagatgactccgatttctttcggtttaattatagattttgagttc 9723138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University