View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10858_low_13 (Length: 337)
Name: NF10858_low_13
Description: NF10858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10858_low_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 75; Significance: 2e-34; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 93 - 174
Target Start/End: Complemental strand, 9723353 - 9723271
Alignment:
| Q |
93 |
tactttttgcattaattccaaaccaccatccataatgtt-cactgtaccctcaacaacaaattaaattgcaacaatatatcta |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9723353 |
tactttttgcattaattccaaaccaccatccataatgtttcactgtaccctcaacaacaaattaaattgcaacaatatatcta |
9723271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 266 - 329
Target Start/End: Complemental strand, 9723135 - 9723072
Alignment:
| Q |
266 |
attcttaagacagaagtttcctgctcattatgatcttatctgactcgagagattagtctctgct |
329 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9723135 |
attcttaagacagaagttttctgctcattatgatcttatctgactcgagagattagtctctgct |
9723072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 171 - 236
Target Start/End: Complemental strand, 9723203 - 9723138
Alignment:
| Q |
171 |
tctaaccaaaagtatttagatgagatgactcggatttcttttagtttaatcataggtcttgagttc |
236 |
Q |
| |
|
|||| |||| ||||||||||||||||||||| ||||||||| ||||||| |||| | |||||||| |
|
|
| T |
9723203 |
tctagccaagagtatttagatgagatgactccgatttctttcggtttaattatagattttgagttc |
9723138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University