View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10858_low_18 (Length: 254)
Name: NF10858_low_18
Description: NF10858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10858_low_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 21 - 244
Target Start/End: Original strand, 29111614 - 29111834
Alignment:
| Q |
21 |
actgaagctaaattcacattcttacccattttttcttgattcacgaacggctatggagtagtgatagtgaagaactgcagaaaccctaacgacgatgtgt |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
29111614 |
actgaagctaaattcacattcttacccattttttcttgattcacgaacggctatggagt---gatagtgaggaactgcagaaaccctaacgacgatgtgt |
29111710 |
T |
|
| Q |
121 |
tatatttatatactttgttcgggttgggcctggagtaacaacccggtcggtgtaggcccgaaaaagtatatttacttttggatgttactttttaggcccc |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29111711 |
tatatttatatactttgttcgggttgggcctggagtaacaacccggtcggtgtaggcccgaaaaagtatatttacttttggatgttactttttagacccc |
29111810 |
T |
|
| Q |
221 |
ctaaaactactaaattagcctttg |
244 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
29111811 |
ctaaaactactaaattagcctttg |
29111834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 212 - 244
Target Start/End: Original strand, 2527846 - 2527878
Alignment:
| Q |
212 |
ttaggccccctaaaactactaaattagcctttg |
244 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
2527846 |
ttaggccccctaaaattactaaattagcctttg |
2527878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University