View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10858_low_23 (Length: 249)
Name: NF10858_low_23
Description: NF10858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10858_low_23 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 3452537 - 3452776
Alignment:
| Q |
1 |
aatatgagggtatttggagaggatctgacgacggcgagaagcatgaggttcatcggtatatgaccaaaagaaatcaccagccatcattactccttcttca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3452537 |
aatatgagggtatttggagaggatctgacgacggcgagaagcatgaggttcatcggtatatgaccaaaagaaatcaccagccatcattactccttcttca |
3452636 |
T |
|
| Q |
101 |
tcttct------cctccgcctttacccattttttctcttgtttctctcacatcacataaacctgtttcatgaatctaacaaacattatatataaagtcaa |
194 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3452637 |
tcttctcctccgcctccgcctttacccattttttctcttgtttctctcacatcacataaacctgtttcatgaatctaacaaacattatatataaagtcaa |
3452736 |
T |
|
| Q |
195 |
aaatatcaaatgtgggaaaaacctaacaatagtgggacac |
234 |
Q |
| |
|
|||||| ||||||||||||| |||| ||||||||||||| |
|
|
| T |
3452737 |
aaatattgaatgtgggaaaaagctaataatagtgggacac |
3452776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University