View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10858_low_29 (Length: 238)
Name: NF10858_low_29
Description: NF10858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10858_low_29 |
 | |
|
| [»] scaffold0023 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0023 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: scaffold0023
Description:
Target: scaffold0023; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 13 - 235
Target Start/End: Original strand, 114526 - 114748
Alignment:
| Q |
13 |
gcttctacttcacaacctagtaatgtccccttaccgtgtgcaatgtggtcggacaatttatggaacctgggggagcaagtaggcaatgacagaatttgct |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
114526 |
gcttctacttcacaacctagtaatgtccccttaccgtgtgcaatgtggtcggacaatttatggaacctgggggagcaagtaggcaatgacagaatttgct |
114625 |
T |
|
| Q |
113 |
catactcttcattacaagaagatatcaacttcaatatggagtttccaaatgttggtaactatttctgggattccaatcttcgtgattatgattcttcttg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
114626 |
catactcttcattacaagaagatatcaacttcaatacggagtttccaaatgttggtaactatttctcggattccaatcttcgtgattatgattcttcttg |
114725 |
T |
|
| Q |
213 |
tgatcattagatcgttgtgtagt |
235 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
114726 |
ggatcattagatcgttgtgtagt |
114748 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 63; Significance: 2e-27; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 32 - 166
Target Start/End: Complemental strand, 33821389 - 33821255
Alignment:
| Q |
32 |
gtaatgtccccttaccgtgtgcaatgtggtcggacaatttatggaacctgggggagcaagtaggcaatgacagaatttgctcatactcttcattacaaga |
131 |
Q |
| |
|
||||||| ||| |||| |||| |||||||||||||| |||||||||| ||||||| |||||| || ||||| |||| |||||| |||||| |||||||| |
|
|
| T |
33821389 |
gtaatgttcccgtaccatgtggaatgtggtcggacagtttatggaacttgggggaacaagtaaacattgacaaaattggctcatgctcttcgttacaaga |
33821290 |
T |
|
| Q |
132 |
agatatcaacttcaatatggagtttccaaatgttg |
166 |
Q |
| |
|
||| | |||||| ||||||||| |||||||||||| |
|
|
| T |
33821289 |
agagaacaactttaatatggaggttccaaatgttg |
33821255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 44 - 131
Target Start/End: Complemental strand, 33733900 - 33733813
Alignment:
| Q |
44 |
taccgtgtgcaatgtggtcggacaatttatggaacctgggggagcaagtaggcaatgacagaatttgctcatactcttcattacaaga |
131 |
Q |
| |
|
||||||||||| ||| |||||||||||||||| || |||| || |||||||||| ||| |||| ||||| ||||||| ||||||| |
|
|
| T |
33733900 |
taccgtgtgcattgtcgtcggacaatttatgggacttgggtgaacaagtaggcagtgagcaaattggctcaggctcttcaatacaaga |
33733813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 44 - 131
Target Start/End: Complemental strand, 33762458 - 33762371
Alignment:
| Q |
44 |
taccgtgtgcaatgtggtcggacaatttatggaacctgggggagcaagtaggcaatgacagaatttgctcatactcttcattacaaga |
131 |
Q |
| |
|
|||| |||||||||| | | || ||||| |||||| ||||||||| ||||| || ||| | |||| |||||| ||||||||||||||| |
|
|
| T |
33762458 |
taccatgtgcaatgttgaccgataatttgtggaacttgggggagccagtagacagtgagaaaattggctcatgctcttcattacaaga |
33762371 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 32 - 94
Target Start/End: Original strand, 5471535 - 5471597
Alignment:
| Q |
32 |
gtaatgtccccttaccgtgtgcaatgtggtcggacaatttatggaacctgggggagcaagtag |
94 |
Q |
| |
|
|||||||||| |||| ||| |||||||||| || | |||||||||| ||||||||||||||| |
|
|
| T |
5471535 |
gtaatgtcccaataccttgtacaatgtggtcagaaagtttatggaacttgggggagcaagtag |
5471597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University