View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10859_low_18 (Length: 239)
Name: NF10859_low_18
Description: NF10859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10859_low_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 54472299 - 54472077
Alignment:
| Q |
1 |
taccgtgtgctggagtagggtagtaatgaatgtgatgaggttgtgatctcttcttccttcttgtacatataacgcagagtaggataatgacaaggaggat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54472299 |
taccgtgtgctggagtagggtagtaatgaatgtgatgaggttgtgatctcttcttccttcttgtacatataacgcagagtaggataatgacaaggaggat |
54472200 |
T |
|
| Q |
101 |
tatacaagctgcacctgcaactgctattataccacccacgctcaattgattcccattgttatcatttgtattgttgccgttgttcgagggtgatgattta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54472199 |
tatacaagctgcacctgcaactgctattataccacccacgctcaattgattcccattgttatcatttgtattgttgccgttgttcgagggtgatgattta |
54472100 |
T |
|
| Q |
201 |
tgatgatgatgtgacgtcggagg |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
54472099 |
tgatgatgatgtgacgtcggagg |
54472077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University