View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10859_low_19 (Length: 236)
Name: NF10859_low_19
Description: NF10859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10859_low_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 94 - 196
Target Start/End: Original strand, 4429316 - 4429418
Alignment:
| Q |
94 |
ctagtaaacttgcactatgacaattattttagaggtgagaaaaacgtaatcacgaggttgaaattaaatttatatttatctgcctctacaaccattctta |
193 |
Q |
| |
|
||||||||| |||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||| |||||||| |
|
|
| T |
4429316 |
ctagtaaacatgcagtatgacaatttttttagaggtgagaaaaacgtaatcacgaggttgaaattaaatttatatatatctgcctcgacaatcattctta |
4429415 |
T |
 |
| Q |
194 |
caa |
196 |
Q |
| |
|
||| |
|
|
| T |
4429416 |
caa |
4429418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 191 - 221
Target Start/End: Original strand, 4429830 - 4429860
Alignment:
| Q |
191 |
ttacaaatgttactgtattggttattatttt |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
4429830 |
ttacaaatgttactgtattggttattatttt |
4429860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University