View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10859_low_20 (Length: 233)
Name: NF10859_low_20
Description: NF10859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10859_low_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 51418422 - 51418635
Alignment:
| Q |
1 |
ctgaacaacgtgatggtgaagcaccatgaagcactcacgtgccgtccacgtgatgctgatatgtatttcatttcaccgttggagtatcagttcagctgta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
51418422 |
ctgaacaacgtgatggtgaagcaccatgaagcactcacgtgccgtccacgtgatgctgatatgtattttatttcaccgttggagtatcagttcagctgta |
51418521 |
T |
 |
| Q |
101 |
gcagcagtccaccgcgtctctctcgtggtgtaaacagtagtaggaggaagctattatctccggttgcagaacgcagtcgccggcaaatgagggtgtatta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
51418522 |
gcagcagtccaccgcgtctctctcgtggtgcaaacagtagtaggaggaagctattatctccggtggcagaacgcagtcgccggcaaatgagggtgtatta |
51418621 |
T |
 |
| Q |
201 |
tggaaccagaaatg |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
51418622 |
tggaaccagaaatg |
51418635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 2 - 163
Target Start/End: Original strand, 51413370 - 51413534
Alignment:
| Q |
2 |
tgaacaacgtgatggtgaagcaccatgaagcactcacgtgccgtccacgtgatgctgatatgtatttcatttcaccgttggagtatcagttcagctgtag |
101 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51413370 |
tgaacagcgtgatggtgaagcaccatgaagcactcacgtgccgaccacgtgatgctgatatgtatttcatttcaccgttggagtatcagttcagctgtag |
51413469 |
T |
 |
| Q |
102 |
cagcagtccaccgcgtctctctc---gtggtgtaaacagtagtaggaggaagctattatctccgg |
163 |
Q |
| |
|
||||||||||| |||||||||| |||| | | |||||||||||||||||| || ||||||| |
|
|
| T |
51413470 |
tagcagtccacctcgtctctctcgcggtggcgccagcagtagtaggaggaagcttttgtctccgg |
51413534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 58 - 163
Target Start/End: Original strand, 51416472 - 51416581
Alignment:
| Q |
58 |
gatatgtatttcatttcaccgttggagtatcagttcagctgtagcagcagtccaccgcgtctctctcg----tggtgtaaacagtagtaggaggaagcta |
153 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||||||||||||||| |||||||| |||| |||| ||||| || ||| |||||||| |||||| |
|
|
| T |
51416472 |
gatatgtatttcgtttcaccgttggaatatcagttcagctgtagcagcaatccaccgcatctcactcgtgcatggtgcaagcagcagtaggagaaagcta |
51416571 |
T |
 |
| Q |
154 |
ttatctccgg |
163 |
Q |
| |
|
|||||||||| |
|
|
| T |
51416572 |
ttatctccgg |
51416581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 19 - 89
Target Start/End: Original strand, 29323690 - 29323760
Alignment:
| Q |
19 |
aagcaccatgaagcactcacgtgccgtccacgtgatgctgatatgtatttcatttcaccgttggagtatca |
89 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29323690 |
aagcaccacgaagcactcatgtgccgtccacgtgatgctgatatgtatttcgtttcaccgttggagtatca |
29323760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University