View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10859_low_21 (Length: 232)
Name: NF10859_low_21
Description: NF10859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10859_low_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 3 - 217
Target Start/End: Original strand, 1122855 - 1123069
Alignment:
| Q |
3 |
tttgaaccgggcaggtgcggattaatttctgaatccatcggtccccgaacccgcctgcatatgcttacagtattttttgtctggatatacacattacttt |
102 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||||||||| || ||||||||| |||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
1122855 |
tttgaaacaggcaggtgcggattaatttctgaatccatcggtaccggaacccgcccgcatatgcttacagtattttttgtctggatatacacgttacttt |
1122954 |
T |
 |
| Q |
103 |
actgagacatcactgtgtcattgtgtcttcaaatcggaaaaagaaagtgtcacatgacctttttactagaatatactcaatttaatattattacttgtaa |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1122955 |
actgagacatcactgtgtcattgtgtcttcaaatcagaaaaagaaagtgtcacgtgacctttttactagaatatactcaatttaatattattacttgtaa |
1123054 |
T |
 |
| Q |
203 |
ctagaagtagaaatt |
217 |
Q |
| |
|
|||| | |||||||| |
|
|
| T |
1123055 |
ctagcactagaaatt |
1123069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University