View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10859_low_23 (Length: 227)
Name: NF10859_low_23
Description: NF10859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10859_low_23 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 35457610 - 35457384
Alignment:
| Q |
1 |
atcttttaacatttcatcaagcattaacataaacactcaaaataaacagcattcacggtaaagcaaagtaacaacctgacaaataatatgattgcttctg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
35457610 |
atcttttaacatttcatcaagcattaacataaacactcaaaataaacagcattcacggtaaagcaaagtaacaacctgaaaaataatatgattgcttctg |
35457511 |
T |
 |
| Q |
101 |
caaaaaattatctctgcaagggttgcatgccaaccaatttgggaatccagtagttgaaaaatcacagcaaaatgtatgaaaacgattgttaaaggagtca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
35457510 |
caaaaaattatctctgcaagggttgcatgccaaccaatttgggaatccagtagttgaaaaatcacagcaaaatggatgaaaacgaatgttaaaggagtca |
35457411 |
T |
 |
| Q |
201 |
actgcattggaattttcatcgataatt |
227 |
Q |
| |
|
||||||||||||||||||| ||||||| |
|
|
| T |
35457410 |
actgcattggaattttcattgataatt |
35457384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University