View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10860_low_19 (Length: 244)
Name: NF10860_low_19
Description: NF10860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10860_low_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 46266634 - 46266401
Alignment:
| Q |
1 |
agtacatcatatacatattatggtacatacataagtttttatttgataattgaagaacgaggatggtgcttctgtctgtagttattatcaatgaggggaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
46266634 |
agtacatcatatacatattatggtacatacatgagtttttatttgataattgaagaacgaggatggtgcttctgtctgtagttattattaatgaggggaa |
46266535 |
T |
 |
| Q |
101 |
gagtcacgtggttattatatatgctatgtaacactgacatctcagattgaaggtgtgtccggtgtctgacacatgttagtgtcggccaatgtgattatct |
200 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46266534 |
gagtcacgtggttattatatattctatgtaacactgacatctcaaattgaaggtgtgtccggtgtctgacacatgttagtgtcggccaatgtgattatct |
46266435 |
T |
 |
| Q |
201 |
ataacaatgtgtcaatgacgtgtttgatgtccat |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
46266434 |
ataacaatgtgtcaatgacgtgtttgatgtccat |
46266401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University