View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10860_low_20 (Length: 242)
Name: NF10860_low_20
Description: NF10860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10860_low_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 42636690 - 42636916
Alignment:
| Q |
1 |
ttttcagtaacagtcttgcgcgacatgatgcgtcttaagcagtgacgagacactttcaactcttcacaattgcgtgacacgtggattgtagcacgcatcg |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
42636690 |
ttttcagtaacagtcttgcgcgatgtgatgcgtcttaagcagtgacgagacactttcaactcttcacaattgcatgacatgtggattgtagcacgcatcg |
42636789 |
T |
 |
| Q |
101 |
tgcatgtactagtagtggatccttttgattttcttcattccttgtcatatttctcctcactgaaatatttgtagtgactatacatnnnnnnntcacctga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
42636790 |
tgcatgtactagtagtggatccttttgattttcttcattccttgtcatatttctcctcactgaaacatttgtagtgactatacatcaaaaaatcacctga |
42636889 |
T |
 |
| Q |
201 |
tataccatctaagaaagtataacatga |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
42636890 |
tataccatctaagaaagtataacatga |
42636916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 86 - 146
Target Start/End: Complemental strand, 23072568 - 23072508
Alignment:
| Q |
86 |
ttgtagcacgcatcgtgcatgtactagtagtggatccttttgattttcttcattccttgtc |
146 |
Q |
| |
|
|||||||||||||| ||||||| |||||| ||||||| || ||||||||||| |||||| |
|
|
| T |
23072568 |
ttgtagcacgcatcaaacatgtaccagtagttgatccttatgcttttcttcattacttgtc |
23072508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University