View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10860_low_25 (Length: 202)
Name: NF10860_low_25
Description: NF10860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10860_low_25 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 19 - 138
Target Start/End: Original strand, 28048520 - 28048639
Alignment:
| Q |
19 |
cataaaccatccgaacattctcatgtcttcaacattgtacttttatatatttttatgactttctttcatctataatctataagttgcatgcaaaattata |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28048520 |
cataaaccatccgaacattctcatgtcttcaacattgtacttttatatatttttatgactttctttcatctataatctataagttgcatgcaaaattata |
28048619 |
T |
 |
| Q |
119 |
ataaatcagggatttcgata |
138 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
28048620 |
ataaatcagggatttcgata |
28048639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University