View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10860_low_9 (Length: 292)
Name: NF10860_low_9
Description: NF10860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10860_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 1 - 271
Target Start/End: Original strand, 45668078 - 45668349
Alignment:
| Q |
1 |
gaatctaccgcagatttgtactaatcaccttgatcctacatcggtaatcataatcattgataattgatttcaattttgtcaactagttagg-agtcttag |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
45668078 |
gaatctaccgcagatttgtactaatcaccttgatcctacatcggtaatcataatcattgataattgatttcaattttgtcaactagttagggagtcttag |
45668177 |
T |
 |
| Q |
100 |
tttcattcgaaagaacagaaaatagatatctctgctaatgcttgcttataacttgaactttcagtgactggttttattactcctttttcagtgtttcttc |
199 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45668178 |
tttcattcaaaagaacagaaaatagatctctctgctaatgcttgcttataacttgaactttcagtgactggttttattactcctttttcagtgtttcttc |
45668277 |
T |
 |
| Q |
200 |
cctcagaatttgattgtcagtgttagaacaccactttttcttctcaatactgcttatgattcatggcaggta |
271 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45668278 |
cctcagaatttgattgccagtgttagaacaccactttttcttctcaatactgcttatgattcatggcaggta |
45668349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University