View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10861_high_4 (Length: 334)
Name: NF10861_high_4
Description: NF10861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10861_high_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 128; Significance: 4e-66; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 14 - 157
Target Start/End: Original strand, 9633402 - 9633545
Alignment:
| Q |
14 |
aggctagaatggttaaaaagagtggtgctccatatatgagcaaggaaaatactagtgaaattaatattgctatggttatttggtatctatattttagaag |
113 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9633402 |
aggctagcatggttaaaaagtgtggtgctccatatatgagcaaggaaaatactagtgaaattaatattgctatggtaatttggtatctatattttagaag |
9633501 |
T |
|
| Q |
114 |
cttttgtgataggtccatggtatcttgaatagtaattttactgc |
157 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
9633502 |
cttttgtgataggaccatggtatcttgaatagtaattttactgc |
9633545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 227 - 319
Target Start/End: Original strand, 9633615 - 9633707
Alignment:
| Q |
227 |
tgtggtgatttctatctaagtgtaggcaagtataattataagttgaagagattctatgttttggaattgatgttcttattggcttttcaaagt |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9633615 |
tgtggtgatttctatctaagtgtaggcaagtataattataagttgaagagattctatgttttggaattgatgttcttattggcttttcaaagt |
9633707 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University