View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10861_high_5 (Length: 316)
Name: NF10861_high_5
Description: NF10861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10861_high_5 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 1 - 316
Target Start/End: Original strand, 32932565 - 32932881
Alignment:
| Q |
1 |
aacaccccttaggcttggggtgagttttctagtctctcgtccattttactatttctcacctgttatg-ttttttgagtgaatatcgaaaatgaattttcg |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
32932565 |
aacaccccttaggcttggggtgagttttctagtctctcatccattttactatttctcacctgttatgtttttttgagtgaatatcaaaaatgaattttcg |
32932664 |
T |
 |
| Q |
100 |
atatcggaatcctctttatttatctaaattacaatatctcaaccatnnnnnnnnnntcttcttatttatttgtaagtggatctagttttctctcatgttt |
199 |
Q |
| |
|
| ||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32932665 |
acatcggaatcctctttatttatctcaattacaatatctcaaccat-caaaataaatcttcttatttatttgtaagtgaatctagttttctctcatgttt |
32932763 |
T |
 |
| Q |
200 |
aatgattgagatgttgcagtat-nnnnnnncatggactttcttttggttgttcctcatcttcagaaaatctttgtgcttataaaatattcttaattacgg |
298 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| ||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
32932764 |
gatgattgagacgttgcagtataaaaaaaacatggactttcctttggttgttcctcatcttcataaaatctttgtgcgtataaaatattcttaattacgg |
32932863 |
T |
 |
| Q |
299 |
tatagtgtaagatctttc |
316 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
32932864 |
tatagtgtaagatctttc |
32932881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University