View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10861_low_1 (Length: 455)
Name: NF10861_low_1
Description: NF10861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10861_low_1 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 237; Significance: 1e-131; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 187 - 439
Target Start/End: Complemental strand, 50365543 - 50365291
Alignment:
| Q |
187 |
accaatcaaacacagtgttagtggcaggagagtaatggaggatatttcttggaagccaccagttataggatggatctgttccaatactgccggcgtgtct |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
50365543 |
accaatcaaacacagtgttagtggcaggagagtaatggaggatatttcttggaagccaccagttataggatggatatgttccaatactgacggcgtgtct |
50365444 |
T |
|
| Q |
287 |
aaaaagggatctatagtcagttgtggatgagtgttgcaaggtgacaatgtggagtggatttgtcgtttctcaaatggattggggagttgtgatgcatatg |
386 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50365443 |
aaaaagggatctatagtcagttgtggatgagtgttgcaaggtgacaatgtggagtggatttgtcgtttctcaaatggattggggagttgtgatgcatatg |
50365344 |
T |
|
| Q |
387 |
tagctgagatttggggtgcgtttgaaggttcaggttgactcttgggtagtagc |
439 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
50365343 |
tagctgagctttggggtgcgtctgaaggttcaggttgactcttgggtagtagc |
50365291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 128; E-Value: 5e-66
Query Start/End: Original strand, 8 - 139
Target Start/End: Complemental strand, 50365722 - 50365591
Alignment:
| Q |
8 |
aagcaaaggtagaaaaggaaatagattgaaaagtagagcttctctcgtctttcttctcaattttggagagaagataaaaagcgtgggacccacaccaaat |
107 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50365722 |
aagcaagggtagaaaaggaaatagattgaaaagtagagcttctctcgtctttcttctcaattttggagagaagataaaaagcgtgggacccacaccaaat |
50365623 |
T |
|
| Q |
108 |
aagcctctctcccaaacaggagaaatgtgaca |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
50365622 |
aagcctctctcccaaacaggagaaatgtgaca |
50365591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 44; Significance: 7e-16; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 281 - 416
Target Start/End: Original strand, 587718 - 587853
Alignment:
| Q |
281 |
gtgtctaaaaagggatctatagtcagttgtggatgagtgttgcaaggtgacaatgtggagtggatttgtcgtttctcaaatggattggggagttgtgatg |
380 |
Q |
| |
|
||||||||| ||||| ||||| |||||||| |||| ||||| ||||| |||| ||||||| ||| |||||||| | ||||| |||||||||||| |
|
|
| T |
587718 |
gtgtctaaagggggatatatagctggttgtggaggagttttgcagggtgaaaatggttagtggatatgtggtttctcagaaggattagggagttgtgatt |
587817 |
T |
|
| Q |
381 |
catatgtagctgagatttggggtgcgtttgaaggtt |
416 |
Q |
| |
|
| ||| |||||||| ||||||||| ||||||||||| |
|
|
| T |
587818 |
cgtatatagctgagctttggggtgtgtttgaaggtt |
587853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 346 - 413
Target Start/End: Complemental strand, 33691814 - 33691747
Alignment:
| Q |
346 |
ttgtcgtttctcaaatggattggggagttgtgatgcatatgtagctgagatttggggtgcgtttgaag |
413 |
Q |
| |
|
|||| ||||| |||| |||||||||||| || ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
33691814 |
ttgtggtttcacaaaaggattggggagtcgtaatgcatatgtagctgagctttggggtgcgtttgaag |
33691747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 47 - 119
Target Start/End: Original strand, 36626725 - 36626797
Alignment:
| Q |
47 |
ttctctcgtctttcttctcaattttggagagaagataaaaagcgtgggacccacaccaaataagcctctctcc |
119 |
Q |
| |
|
|||||| |||||||||| || |||||||||||||| | |||||||| | |||||||||||| || |||||||| |
|
|
| T |
36626725 |
ttctcttgtctttcttcacagttttggagagaagagataaagcgtgtgccccacaccaaattagtctctctcc |
36626797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 34 - 118
Target Start/End: Complemental strand, 1180519 - 1180435
Alignment:
| Q |
34 |
tgaaaagtagagcttctctcgtctttcttctcaattttggagagaagataaaaagcgtgggacccacaccaaataagcctctctc |
118 |
Q |
| |
|
||||||||||| |||||||||||||||||| || |||| || ||| | |||||||||||||||||||||| | ||| |||||| |
|
|
| T |
1180519 |
tgaaaagtagaacttctctcgtctttcttcgaaagtttgaagggaaaagcaaaagcgtgggacccacaccaatttagcatctctc |
1180435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 35 - 118
Target Start/End: Complemental strand, 1155898 - 1155815
Alignment:
| Q |
35 |
gaaaagtagagcttctctcgtctttcttctcaattttggagagaagataaaaagcgtgggacccacaccaaataagcctctctc |
118 |
Q |
| |
|
||||| |||| |||||||||||||||||| ||| |||| || ||| | |||||||||||||||||||||| | ||| |||||| |
|
|
| T |
1155898 |
gaaaaatagaacttctctcgtctttcttcgcaagtttgaagggaaaagcaaaagcgtgggacccacaccaatttagcatctctc |
1155815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University