View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10861_low_14 (Length: 312)
Name: NF10861_low_14
Description: NF10861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10861_low_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 12 - 296
Target Start/End: Complemental strand, 961340 - 961070
Alignment:
| Q |
12 |
ataggcaggcacgtatggtacgcggagtannnnnnncttcttcttatgacaatcaagttttatgtgtagtttcattaatgtaacaacaaagattcttttt |
111 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
961340 |
ataggcaggcacgtatggtacgcggagtatttttt--ttcttcttatgacaatcaatttttatgtgtagtttcatt---gtaacaacaaagattctt--- |
961249 |
T |
 |
| Q |
112 |
taagggatcattgttatcaaagataaactcttcatgtcttcaaaggttggtcaaagcagcaaatgactgcttgtatttttggatgagcatgtcaaaatta |
211 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
961248 |
------atcattgctatcaaagataaactcttcatgtcttcaaaagttggtcaaagaagcaaatgactgcttgtatttttggatgagcatgtcaaaatta |
961155 |
T |
 |
| Q |
212 |
cggcgatacgataattttggagagtcaacaaaacatagtttttgtcgaaattgtagtggctcatcataattctaattgttcaatt |
296 |
Q |
| |
|
||| ||||| |||||||||||||||||||||||||||||||||||||||||| ||||| ||| |||||| ||||||| ||||| |
|
|
| T |
961154 |
cggtgatactataattttggagagtcaacaaaacatagtttttgtcgaaattacagtggttcactataattttaattgtccaatt |
961070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University