View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10861_low_15 (Length: 293)
Name: NF10861_low_15
Description: NF10861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10861_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 12 - 274
Target Start/End: Complemental strand, 35889999 - 35889718
Alignment:
| Q |
12 |
aagcagagagtgttaaggctacgccggtgaagaaagcggcgaagaaggtggttgcaaagaagccgaagagtgttaagactccggtgaagaaagctaagaa |
111 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35889999 |
aagcaaagagtgtgaaggctacgccggtgaagaaagcggcgaagaaggtggttgcaaagaagccgaagagtgttaagactccggtgaagaaagctaagaa |
35889900 |
T |
 |
| Q |
112 |
gtgaaaattagggtttaatttggggatttttagtgatgtgtgaaatttgagggttt--------------attagagttggattttattatc-----ata |
192 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||| |
|
|
| T |
35889899 |
gtgaaaattagggtttaatttgggaatttttagtgatgtgtgaaatttgagggtttattattatatgagtattagagttggattttattatcataatata |
35889800 |
T |
 |
| Q |
193 |
atataatattattaggaagttgttgctgtaaattctttgataggaacatatctaatgttcttgtattatctctacaaatcct |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35889799 |
atataatattattaggaagttgttgctgtaaattctttgataggaacatatctaatgttcttgtattatctctacaaatcct |
35889718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University