View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10861_low_20 (Length: 271)
Name: NF10861_low_20
Description: NF10861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10861_low_20 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 15 - 207
Target Start/End: Complemental strand, 36458347 - 36458155
Alignment:
| Q |
15 |
atgaaggacatttattttgtcaacaatggaatcactatgcacgcaggggtgttatttggtttagaagtgacagtttaggattagaaaaagaaaattgtaa |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36458347 |
atgaaggacatttattttgtcaacaatggaatcactatgcacgcaggggtgttatttgggttagaagtgacagtttaggattagaaaaagaaaattgtaa |
36458248 |
T |
|
| Q |
115 |
aaatatattggtattctttgttttggaatcaacgttattactttaatgtctatattactactttagtttctctaaagcttatcatgaattaga |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36458247 |
aaatatattggtattctttgttttggaatcaacgttattactttaatgtctatattactactttagtttctctaaagcttatcatgaaataga |
36458155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 215 - 257
Target Start/End: Complemental strand, 36458164 - 36458122
Alignment:
| Q |
215 |
atgaaatagagagccacataaagtgaaagcctattatccaacc |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36458164 |
atgaaatagagagccacataaagtgaaagcctattatccaacc |
36458122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University