View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10861_low_23 (Length: 250)
Name: NF10861_low_23
Description: NF10861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10861_low_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 102; Significance: 9e-51; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 46002467 - 46002678
Alignment:
| Q |
1 |
aatccaatctatcgacaaactagttaggtcaattgtctgatttgtaaaacaatgatagtaagattannnnnnnnnnnnnnnaaaagtcagtagttaacct |
100 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
46002467 |
aatccaatcaatcgacaaactagttaggtcaattgtccgatttgtaaaacaatgatactaagatt--ttttatttttttttaaaagtcagtagttaacct |
46002564 |
T |
 |
| Q |
101 |
atatatacannnnnnnnn-cttctaagtaagctcatcttgttttttatggaaaaattaagtaaactaactcaaacgtgaataaaaaacacaagtgaaagt |
199 |
Q |
| |
|
||||||||| |||||||||||||| ||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46002565 |
atatatacattttttttttcttctaagtaagctaatcttcttttttttggaaaaattaagtaaactaactcaaacgtgaataaaaaacacaagtgaaagt |
46002664 |
T |
 |
| Q |
200 |
tgtctccattttca |
213 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
46002665 |
tgtctccattttca |
46002678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University