View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10861_low_27 (Length: 239)

Name: NF10861_low_27
Description: NF10861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10861_low_27
NF10861_low_27
[»] chr1 (1 HSPs)
chr1 (12-204)||(46002152-46002345)


Alignment Details
Target: chr1 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 12 - 204
Target Start/End: Complemental strand, 46002345 - 46002152
Alignment:
12 catctaatttaactcgactctagttgaatcgattgaatcatgactagagatctcaccgattcgatattatggtttttgaaatattccttcaatgtattta 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
46002345 catctaatttaactcgactctagttgaatcgattgaatcatgactagagatctcaccgatttgatattatggtttttgaaatattccttcaatgtattta 46002246  T
112 cctgaannnnnnncagctacggaacatatggtggcagcctggcagggggtaa-ttagtccttggaaaggttcaaatttatgcctcggtaacatt 204  Q
    ||||||       ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||    
46002245 cctgaatttttttcagctacggaacatatggtggcagcctggcagggggtaatttagtccttggaaaggttcaaacttatgcctcggtaacatt 46002152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University