View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10861_low_30 (Length: 210)
Name: NF10861_low_30
Description: NF10861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10861_low_30 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 181; Significance: 5e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 181; E-Value: 5e-98
Query Start/End: Original strand, 1 - 210
Target Start/End: Complemental strand, 38592784 - 38592575
Alignment:
| Q |
1 |
acgataaaataaaatgtattctatacttcnnnnnnngtacaatatttcatgttatctttattaaaggaatcatcaaattaaatctatatatcaagactca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38592784 |
acgataaaataaaatgtattctatacttctttttttgtacaatatttcatgttatctttattaaaggaatcatcaaattaaatctatatatcaagactca |
38592685 |
T |
 |
| Q |
101 |
atttcatgttattttatttatatatatgtcgatcaatcaaaccatagcatgatacttttatatcatgtaggaaaaatgattttattgccgtgtatcatat |
200 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38592684 |
atttcatgtcattttatttatatatatgtcgatcaatcaaaccatagcatgatacttttatttcatgtaggaaaaatgattttattgccgtgtatcatat |
38592585 |
T |
 |
| Q |
201 |
caatatgtat |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
38592584 |
caatatgtat |
38592575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University