View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10862_high_36 (Length: 219)
Name: NF10862_high_36
Description: NF10862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10862_high_36 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 91; Significance: 3e-44; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 1 - 95
Target Start/End: Complemental strand, 8133310 - 8133216
Alignment:
| Q |
1 |
caagtttctgcttagtgaataagttgccattctcattgatcataaaaatctctagagtctaacatgtgaattttcttcttcattcatcactgcag |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
8133310 |
caagtttctgcttagtgaataagttgccattctcattgatcataaaaatctctagagtctaacatgtgaattttcttcttcattcttcactgcag |
8133216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 79
Target Start/End: Complemental strand, 8151252 - 8151172
Alignment:
| Q |
1 |
caagtttctgcttagtgaataag--ttgccattctcattgatcataaaaatctctagagtctaacatgtgaattttcttct |
79 |
Q |
| |
|
||||||| ||||| | ||||||| ||| |||||||||||||||| |||||||||| ||||| | |||||||||||||||| |
|
|
| T |
8151252 |
caagtttttgctttgcgaataagaattgacattctcattgatcatgaaaatctctaaagtctgagatgtgaattttcttct |
8151172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 28 - 90
Target Start/End: Complemental strand, 2806938 - 2806877
Alignment:
| Q |
28 |
cattctcattgatcataaaaatctctagagtctaacatgtgaattttcttcttcattcatcac |
90 |
Q |
| |
|
||||||||||||| |||||||||||| ||||| ||||||||| ||| ||||| ||||||||| |
|
|
| T |
2806938 |
cattctcattgattataaaaatctctgaagtctgacatgtgaaattt-ttcttaattcatcac |
2806877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University