View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10862_high_37 (Length: 215)
Name: NF10862_high_37
Description: NF10862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10862_high_37 |
 |  |
|
| [»] scaffold0003 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 181; Significance: 6e-98; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 15 - 199
Target Start/End: Original strand, 27606282 - 27606466
Alignment:
| Q |
15 |
cacagattcagttctttatcccatatgagttcctttagatcagaatgcttttttcctacaaggatagtacgtttagtttaagaaacccatccaaccatag |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27606282 |
cacagattcagttctttatcccatatgagttcctttagatcagaatgcttttttcctgcaaggatagtacgtttagtttaagaaacccatccaaccatag |
27606381 |
T |
 |
| Q |
115 |
ccgttttgaataaaatattaataaaagtacttacaatagcaacaaatacaaaacatgtttcattatgaaaatttaaggttagaac |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27606382 |
ccgttttgaataaaatattaataaaagtacttacaatagcaacaaatacaaaacatgtttcattatgaaaatttaaggttagaac |
27606466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 85 - 123
Target Start/End: Original strand, 27418630 - 27418668
Alignment:
| Q |
85 |
gtttagtttaagaaacccatccaaccatagccgttttga |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
27418630 |
gtttagtttaagaaacccatccaaccatagccattttga |
27418668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 85 - 123
Target Start/End: Complemental strand, 68733 - 68695
Alignment:
| Q |
85 |
gtttagtttaagaaacccatccaaccatagccgttttga |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
68733 |
gtttagtttaagaaacccatccaaccatagccattttga |
68695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 85 - 123
Target Start/End: Complemental strand, 5083572 - 5083534
Alignment:
| Q |
85 |
gtttagtttaagaaacccatccaaccatagccgttttga |
123 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
5083572 |
gtttagtttgagaaatccatccaaccatagccgttttga |
5083534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University