View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10862_high_9 (Length: 361)
Name: NF10862_high_9
Description: NF10862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10862_high_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 19 - 350
Target Start/End: Original strand, 33262305 - 33262626
Alignment:
| Q |
19 |
ataatgtcacaattcaaaagaagcaaaatattgtcattaatcatttctccctttaatgttgaaacaaatgttgatcccttgctgaattttggaagatatg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | || |||| |
|
|
| T |
33262305 |
ataatgtcacaattcaaaagaagcaaaatattgtcattaatcatttctccctttaatgttgaaacaaatgttgatcccttgct------ttgat--tatg |
33262396 |
T |
 |
| Q |
119 |
tatggtaactatgtaattaacacacaatatcaaacaatgttatgtaatgactggctgaattttggaagatatgttgcaatttgtaagctcagaataagga |
218 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
33262397 |
tatggtaactatgtaattaacac--aatatcaaacaatgttatgtaatgactggctgaattttggaagatatgttggaatttgtaagctctgaataagga |
33262494 |
T |
 |
| Q |
219 |
gcagatatcttcattgaagtagcatccatatagaaaaacatgtttcgtctgtgtgtccatcatcctaaatccagcattttccatcacagaactttcttta |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33262495 |
gcagatatcttcattgaagtagcatccatatagaaaaacatgtttcttctgtgtgtccatcatcctaaatccagcattttccatcacagaactttcttta |
33262594 |
T |
 |
| Q |
319 |
aataagaatcaactttagcactttacattcat |
350 |
Q |
| |
|
| |||||||||||||||||||||||||||||| |
|
|
| T |
33262595 |
actaagaatcaactttagcactttacattcat |
33262626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University