View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10862_low_13 (Length: 347)
Name: NF10862_low_13
Description: NF10862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10862_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 104; Significance: 8e-52; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 104; E-Value: 8e-52
Query Start/End: Original strand, 229 - 336
Target Start/End: Complemental strand, 11931666 - 11931559
Alignment:
| Q |
229 |
ttgatttggatgaattttaaggtttcgttagaagtgtttatgatccggacacaaacagccatgcgcagaagctaaagacagatcgttcattgcttagaag |
328 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11931666 |
ttgatttggatgaattttaaggtttcgttagaagtgtttatgatcaggacacaaacagccatgcgcagaagctaaagacagatcgttcattgcttagaag |
11931567 |
T |
 |
| Q |
329 |
gtattcat |
336 |
Q |
| |
|
|||||||| |
|
|
| T |
11931566 |
gtattcat |
11931559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University