View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10862_low_20 (Length: 316)
Name: NF10862_low_20
Description: NF10862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10862_low_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 11 - 301
Target Start/End: Complemental strand, 45763253 - 45762963
Alignment:
| Q |
11 |
caaaggctgatgagcgttaccggcgatcaaaaacatcatgaagaagacgcattgaagttgttaccggagaatataggtggtggcgctggtggaggtggtt |
110 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
45763253 |
caaaagctgatgagcgttaccggcgatcaaaaacatcatgaagaagacgcattgaagttgttaccggagaatataggtggtggtgctggtggaggtggtt |
45763154 |
T |
 |
| Q |
111 |
cttcgggttctggatcgttgctggaccatggtattgatttctctttgctgcagagtaaaacaagcaacggtggatttggatcgttggattggaatggtga |
210 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45763153 |
cttctggttctggatcgttgatggaccatggtattgatttctctttgctgcagagtaaaacaagcaacggtggatttggatcgttggattggaatggtga |
45763054 |
T |
 |
| Q |
211 |
tggtagtgctgatcatcaaggtttgtttgatcttcctaacaccgttgatcatggttactggaatcacactcaatggtctgatcaggatcat |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45763053 |
tggtagtgctgatcatcaaggtttgtttgatcttcctaacaccgttgatcatggttactggaatcacactcaatggtctgatcaggatcat |
45762963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University