View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10862_low_23 (Length: 309)
Name: NF10862_low_23
Description: NF10862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10862_low_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 1 - 293
Target Start/End: Complemental strand, 49645407 - 49645115
Alignment:
| Q |
1 |
tgtttaaaatactcattatcacaatatttactctttcataagtcagaacattaaaaatgtgtctaagacccgcgtcattggcaatgagatgcagattaca |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
49645407 |
tgtttaaaatactcattatcacagtatttactctttcataagtcagaacattaaaaatgtgtctaagacccgcgtcattgccaatgagatgcagattaca |
49645308 |
T |
|
| Q |
101 |
gaatatcaacggcgcaataataatttaaaatctatcaagatgcccgacacataccattcaaaaatgagaatttctacggtgtgcaaaaatcaactactcg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49645307 |
gaatatcaacggcgcaataataatttaaaatctatcaagatgcccgacacataccattcgaaaatgagaatttctacggtgtgcaaaaatcaactactcg |
49645208 |
T |
|
| Q |
201 |
ggttgttattaaaattatggttaaaatgtttatttatttattttgacaagaattatggttaaaatgtttaatgagttagcgtagctagttagt |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49645207 |
ggttgttattaaaattatggttaaaatgtttatttatttattttgacaagaattatggttaaaatgtttaatgagttagcgtagctagttagt |
49645115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University