View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10862_low_25 (Length: 281)
Name: NF10862_low_25
Description: NF10862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10862_low_25 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 19 - 273
Target Start/End: Complemental strand, 27790979 - 27790727
Alignment:
| Q |
19 |
cctttaaatctggaaagtctttgtttccatatccacatcactctctctcaaacaccaatcctgcatgggcacaacaatgtccatctctataaaaatgcat |
118 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
27790979 |
cctttaaatctgggaagtctttgtttccatatccacatcactctctc--aaacaccaatcctgcatgagcacaacaatgtccatctctataaaaatgcat |
27790882 |
T |
|
| Q |
119 |
ggtctcgtgaacnnnnnnnaatagattagattgtgattaggtacactttgttgagaatctcatgcaataataaattaattacttctgccaaaagcaatta |
218 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
27790881 |
ggtctcatgaactttttttaatagattagattgtgattaggtacactttgttgagaatctcatgcaataataaattaattacttctgccaaaagtaatta |
27790782 |
T |
|
| Q |
219 |
atcaaccaaatagttatttaaccccaccactgatgaactgctactccttcatctc |
273 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27790781 |
atcaaccaaatagttaattaaccccaccactgatgaactgctactccttcatctc |
27790727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University