View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10862_low_28 (Length: 255)
Name: NF10862_low_28
Description: NF10862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10862_low_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 14 - 245
Target Start/End: Original strand, 41705330 - 41705561
Alignment:
| Q |
14 |
catttatgacaaattaatcccacccccaccaatgtcagaagatagccacatgcaaatctcaaacaaattaatcaaaattaaatgctctttcctaccattc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41705330 |
catttatgacaaattaatcccacccccaccaatgtcagaagatagccacatgcaaatctcaaacaaattaatcaaaattaaatgctctttcctaccattc |
41705429 |
T |
 |
| Q |
114 |
aattaatgactctcgtctcgtctctacaatttgccagacctacactgcacacgccaccaccaccatttaattactccctttcattgacctctctcaccaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41705430 |
aattaatgactctcgtctcgtctctacaatttgccagacctacactgcacacgccaccaccaccatttaattactccctttcattgacctctctcaccaa |
41705529 |
T |
 |
| Q |
214 |
tcacgttcttccacgtgtctgtactcttcatc |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
41705530 |
tcacgttcttccacgtgtctgtactcttcatc |
41705561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 51 - 111
Target Start/End: Complemental strand, 6980437 - 6980375
Alignment:
| Q |
51 |
gaagatagccacatgcaaatctcaaaca--aattaatcaaaattaaatgctctttcctaccat |
111 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||||| |||||||||| ||||||||||| |
|
|
| T |
6980437 |
gaagatagccacatgcaaatctcaaagagcaattaatcaatattaaatgctttttcctaccat |
6980375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 167 - 242
Target Start/End: Original strand, 45334867 - 45334941
Alignment:
| Q |
167 |
ccaccaccaccatttaattactccctttcattgacctctctcaccaatcacgttcttccacgtgtctgtactcttc |
242 |
Q |
| |
|
||||||||||||| |||||||||| |||||||||| ||| ||||||| || |||||||| |||||||| |||||| |
|
|
| T |
45334867 |
ccaccaccaccatctaattactcc-tttcattgacatctatcaccaaccatattcttccatgtgtctgtcctcttc |
45334941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University