View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10862_low_29 (Length: 251)
Name: NF10862_low_29
Description: NF10862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10862_low_29 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 57; Significance: 7e-24; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 175 - 247
Target Start/End: Complemental strand, 31037022 - 31036950
Alignment:
| Q |
175 |
aaggcaccacacaagctttaagaaacttgaccaatccttaatgtcacataatccaactttgtctctgcttctc |
247 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
31037022 |
aaggtaccacacaagctttaagaaacttgaccaaaccttaatgtcaaataatccaactttgtctcagcttctc |
31036950 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 76 - 146
Target Start/End: Complemental strand, 31074289 - 31074219
Alignment:
| Q |
76 |
tgatgtatgctcaaaagaaacttgattcaatttcaatactagtgctcgaaatacttcggttgtctaatgtt |
146 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||||||||| | ||||| ||||| |||| || ||||||||| |
|
|
| T |
31074289 |
tgatgtgtgctcaaaagaaacttaatttaatttcaataccaatgctcaaaataattcgattctctaatgtt |
31074219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University