View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10862_low_32 (Length: 241)
Name: NF10862_low_32
Description: NF10862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10862_low_32 |
 | |
|
| [»] chr6 (2 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 182; Significance: 2e-98; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 18 - 241
Target Start/End: Original strand, 8132861 - 8133087
Alignment:
| Q |
18 |
accgacaacctcttccaatttctgatctctctttcaaacaatttatgtctcttgtgttcgacatgtgtctgacacacaacaccgacacacttgattatcg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
8132861 |
accgacaacctcttccaatttctgatctctctttcaaacaatttatgtctcttgtgttcgacatgtgtctgacaca--acactgacacacttgattatca |
8132958 |
T |
|
| Q |
118 |
gtattgacgtgtctattatattaggtgtttggtgttcgtatctgagtcatgtcacattgtgtacatgttttgtggatttaattgaat-----tgtaatat |
212 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
8132959 |
gtattgacgtgtctattatattcggtgtttggtgttcgtatctgagtcatgtcacattctgtacatgttttgtggatttaattgaattagtatgtaatat |
8133058 |
T |
|
| Q |
213 |
tctgccttttgttgcagtatacgttattc |
241 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
8133059 |
tctgccttttgttgcagtatacgttattc |
8133087 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 18 - 61
Target Start/End: Original strand, 2806652 - 2806695
Alignment:
| Q |
18 |
accgacaacctcttccaatttctgatctctctttcaaacaattt |
61 |
Q |
| |
|
||||||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
2806652 |
accgacaaccttttccaatttctgatctctgtttcaaacaattt |
2806695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 21 - 57
Target Start/End: Original strand, 43068722 - 43068758
Alignment:
| Q |
21 |
gacaacctcttccaatttctgatctctctttcaaaca |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43068722 |
gacaacctcttccaatttctgatctctctttcaaaca |
43068758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University