View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10862_low_33 (Length: 240)
Name: NF10862_low_33
Description: NF10862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10862_low_33 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 92; Significance: 8e-45; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 1 - 154
Target Start/End: Complemental strand, 20870363 - 20870208
Alignment:
| Q |
1 |
aatcagaagaaacccaaagttaccttgcttgtgctagcaaatc-nnnnnnnnnnnnnnnnctt-aaagaatgagtaatgtagagaagaaggaggctttaa |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
20870363 |
aatcagaagaaacccaaagttaccttgcttgtgctagcaaatcaaaaaaataaaaaaaaacttgaaagaatgagtaatgtagagaagaaggaggctttaa |
20870264 |
T |
 |
| Q |
99 |
ggagaatgttagagaatgatgaagaaactgataaagatccttcttctgctgatctg |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20870263 |
ggagaatgttagagaatgatgaagaaactgataaagatccttcttctgctgatctg |
20870208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University