View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10862_low_37 (Length: 238)
Name: NF10862_low_37
Description: NF10862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10862_low_37 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 14 - 220
Target Start/End: Complemental strand, 7716584 - 7716377
Alignment:
| Q |
14 |
caaaggaagctagaatcaaattaaagggaaacataatgcactattactagcaaacaaattaaatttcc-aagtactcaaattacataggaagcaacaaat |
112 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
7716584 |
caaagcaagctagaatcaaattaaagagaaacataatgcactattactagcaaacaaattaaatttcctaagtactcaaattacataggaagcaacaaat |
7716485 |
T |
 |
| Q |
113 |
gccaaaacaaacacaatttgaaaaacaccaacaggaacatggtaaccagaagacttagaatgaacatcttgaatcatcactctaacaatcatcttttgtc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7716484 |
gccaaaacaaacacaatttgaaaaacaccaacaggaacatggtaaccagaagacttagaatgaacatcttgaatcatcactctaacaatcatcttttgtc |
7716385 |
T |
 |
| Q |
213 |
ctttctca |
220 |
Q |
| |
|
|||||||| |
|
|
| T |
7716384 |
ctttctca |
7716377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University