View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10863_2 (Length: 351)
Name: NF10863_2
Description: NF10863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10863_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 161; Significance: 8e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 161; E-Value: 8e-86
Query Start/End: Original strand, 137 - 318
Target Start/End: Complemental strand, 43855615 - 43855430
Alignment:
| Q |
137 |
taaaagtgtagcctgcattttggagatcggaagagatgatggatgcgttttcggagttattaagaatgtttatttctctgttttagttactccacgatga |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43855615 |
taaaagtgtagcctgcattttggagatcggaaaagatgatgaatgcgttttcggagttattaagaatgtttatttctctgttttagttactccacgatga |
43855516 |
T |
|
| Q |
237 |
tggagcgtgaatgtgggagagaaaaacaattgaatg----aatgcgtttgaattgaatgaataaataatgagagaaggtgaaacag |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43855515 |
tggagcgtgaatgtgggagagaaaaacaattgaatgaatgaatgcgtttgaattgaatgaataaataatgagagaaggtgaaacag |
43855430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University