View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10864_low_1 (Length: 359)
Name: NF10864_low_1
Description: NF10864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10864_low_1 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 18 - 349
Target Start/End: Original strand, 36767134 - 36767471
Alignment:
| Q |
18 |
ccacctcccgccgcaacaacaacctcatcctctccgccgctgctacttccggtgacaccaccgtctcctccaacggccctc------ctccttcaccttc |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
36767134 |
ccacctcccgccgcaacaacaacctcatcctctccgccgctgctacttccggtgacaccaccgtctcctccaacggccctcctcctcctccttcaccttc |
36767233 |
T |
|
| Q |
112 |
tcgatcaaagtaagtattctctaatcaattagactaatattctgatttgtgattaattaattgattgattattgataatgctgcagagttcggagacaca |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36767234 |
tcgatcaaagtaagtattctctaatcaattatactaatattctgatttgtgattaattaattgattgattattgataatgctgcagagttcggagacaca |
36767333 |
T |
|
| Q |
212 |
cgatttcggtgttcgttggtgatgagagtggaatgattaaccgaatagctggagtgttcgcaagaagaggatacaacattgagtcattagctgttggttt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36767334 |
cgatttcggtgttcgttggtgatgagagtggaatgattaaccgaatagctggagtgttcgcaagaagaggatacaacattgagtcattagctgttggttt |
36767433 |
T |
|
| Q |
312 |
gaatcaagatagggctcttttcaccattgttgtctctg |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36767434 |
gaatcaagatagggctcttttcaccattgttgtttctg |
36767471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University