View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10865A_high_12 (Length: 359)
Name: NF10865A_high_12
Description: NF10865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10865A_high_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 154; Significance: 1e-81; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 1 - 162
Target Start/End: Original strand, 21830964 - 21831125
Alignment:
| Q |
1 |
cggttatatgtttcaaagaaatgtaagtcgtcctcgtcgtcgccgaggccgtcccaattcatggtcagcgtctttcggcgttccatggtggccatcggcg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
21830964 |
cggttatatgtttcaaagaaatgtaagtcgtcctcgtcgtcgccgaggccgtcccaattcatggtcagcgtttttctgcgttccatggtggccatcggcg |
21831063 |
T |
 |
| Q |
101 |
gcaggaggttttggaaatggaatggaaaacgctatgacaaatatgaaatgtaatggaaaacg |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21831064 |
gcaggaggttttggaaatggaatggaaaacgctatgacaaatatgaaatgtaatggaaaacg |
21831125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 273 - 344
Target Start/End: Original strand, 21831237 - 21831309
Alignment:
| Q |
273 |
gtgttgtgttt-ggtagagaagtggaagagaggaaattgagggaagaaggagaggtcggttacggttatggat |
344 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
21831237 |
gtgttgtgttttggtagagaagtggaagagaggaaattgagggaagaaggagaggtcggttacagttatggat |
21831309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University