View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10865A_high_13 (Length: 351)
Name: NF10865A_high_13
Description: NF10865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10865A_high_13 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 299; Significance: 1e-168; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 1 - 351
Target Start/End: Complemental strand, 21831011 - 21830661
Alignment:
| Q |
1 |
cctcggcgccgacgaggaccacttacatttcttttaaacatataaccgcctctccaccgccgtccccgatggcttagcttcttcttctgatgaagatgat |
100 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||| ||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
21831011 |
cctcggcgacgacgaggacgacttacatttctttgaaacatataaccgtctctccaccgccgtccccgatgacttagcttcttcttctgatgaagatgat |
21830912 |
T |
 |
| Q |
101 |
gattatgaaaatagccggttatcctttgcctctgcagtctcctcatttcaccctgccaaacaccggaagccggagcttcccccggctaccggcattgctc |
200 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21830911 |
gattatgaagatagccggttatcctttgcctctgcagtctcctcctttcacccttccaaacaccggaagccggagcttcccccggctaccggcattgctc |
21830812 |
T |
 |
| Q |
201 |
ctaactatgatatatggatggctgctccgggatccatcacggaaagaagacgaagattgcttggaagtatgggattagatgaaaataaagagaatcttaa |
300 |
Q |
| |
|
| |||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
21830811 |
caaactatgatatatggatggctgctccgggatctatcacagaaagaagacgaagattgcttggaagtatgggattggatgaaaataaagagaatcttaa |
21830712 |
T |
 |
| Q |
301 |
agccactagcattgttattagccgcgccatcacgaaaaaattcgagaacaa |
351 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21830711 |
agctactagcattgttattagccgcgccatcacgaaaaaattcgagaacaa |
21830661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University