View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10865A_high_31 (Length: 202)
Name: NF10865A_high_31
Description: NF10865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10865A_high_31 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
| [»] scaffold0035 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 176; Significance: 5e-95; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 23 - 202
Target Start/End: Complemental strand, 5832045 - 5831866
Alignment:
| Q |
23 |
aaggaagagttgctgataattcaattgggccattagagatttgtgtggtgaaaaatggcacgtttgaggaactaatggattatgcaatatcgcgtggtgc |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5832045 |
aaggaagagttgctgataattcaattgggccattagagattcgtgtggtgaaaaatggcacgtttgaggaactaatggattatgcaatatcgcgtggtgc |
5831946 |
T |
 |
| Q |
123 |
aagtatcaatcagtataaagttcctaggtgcgtgagtttcactcctataatggaacttcttgactctagggtggtatcag |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5831945 |
aagtatcaatcagtataaagttcctaggtgcgtgagtttcactcctataatggaacttcttgactctagggtggtatcag |
5831866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 23 - 190
Target Start/End: Original strand, 5823994 - 5824161
Alignment:
| Q |
23 |
aaggaagagttgctgataattcaattgggccattagagatttgtgtggtgaaaaatggcacgtttgaggaactaatggattatgcaatatcgcgtggtgc |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| || ||||| | ||||||||| |||||| ||||||| |
|
|
| T |
5823994 |
aaggaagagttgctgataattcaattgggccattagagattcgtgtggtgaaaaatggcacattcgaggatttgatggattattatatatcgtgtggtgc |
5824093 |
T |
 |
| Q |
123 |
aagtatcaatcagtataaagttcctaggtgcgtgagtttcactcctataatggaacttcttgactcta |
190 |
Q |
| |
|
| || ||||| |||||||||||||||||||||||| |||| ||| || |||||||||||||||||| |
|
|
| T |
5824094 |
atcgattaatcaatataaagttcctaggtgcgtgagtctcacacctgtagtggaacttcttgactcta |
5824161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0035 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: scaffold0035
Description:
Target: scaffold0035; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 31 - 197
Target Start/End: Original strand, 78763 - 78929
Alignment:
| Q |
31 |
gttgctgataattcaattgggccattagagatttgtgtggtgaaaaatggcacgtttgaggaactaatggattatgcaatatcgcgtggtgcaagtatca |
130 |
Q |
| |
|
||||||||| |||||||||| ||||| ||||| | || ||||| | ||| || |||||||| || |||||||||||||| || | ||||| || | |
|
|
| T |
78763 |
gttgctgatcattcaattggaccattggagataagggttgtgaagagtggaacttttgaggagcttatggattatgcaatctcaagaggtgcttcaataa |
78862 |
T |
 |
| Q |
131 |
atcagtataaagttcctaggtgcgtgagtttcactcctataatggaacttcttgactctagggtggt |
197 |
Q |
| |
|
|||| ||||||||||| ||||| || | ||| |||||||||||||| ||| | |||||||||||||| |
|
|
| T |
78863 |
atcaatataaagttccaaggtgtgttaattttactcctataatggagcttttggactctagggtggt |
78929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University