View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10865A_low_100 (Length: 339)
Name: NF10865A_low_100
Description: NF10865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10865A_low_100 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 8 - 117
Target Start/End: Original strand, 30025527 - 30025636
Alignment:
| Q |
8 |
atataagtgttttcaacatggcatcaatggatcatacaaacgtatcctccagcatcaacatgctattcacagaagctaaaataatcttttgagtacgttt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30025527 |
atataagtgttttcaacatggcatcaatggatcatacaaacgtatcctccagcatcaacatgctattcacagaagctaaaataatcttttgagtacgttt |
30025626 |
T |
|
| Q |
108 |
caaagtcttt |
117 |
Q |
| |
|
|||||||||| |
|
|
| T |
30025627 |
caaagtcttt |
30025636 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University