View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10865A_low_121 (Length: 322)
Name: NF10865A_low_121
Description: NF10865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10865A_low_121 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 9 - 322
Target Start/End: Original strand, 31718167 - 31718473
Alignment:
| Q |
9 |
tggtgtttattataaattgcaatgagtatattattggctgtttgttttcttgcttcccatctttagctgaacagtgggaatgatgaagatgatcttactg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31718167 |
tggtgtttattataaattgcaatgagtatatt---ggctgtttgttttcttgcttcccatctttagctgaacagtgggaatgatgaagatgatcttactg |
31718263 |
T |
 |
| Q |
109 |
atgaccgggaagatcttgatgaagcgggaaattcgtgtcaagatgcatcagatgaatgccttaaaagtgaatcgatcgatttccatgtgcctagccaccc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
31718264 |
atgaccgggaagatcttgatgaagcgggaaattcgtgtcaatatgcatcagatgaatgccttaagagtga----atcgatttccatgtgcctagccaccc |
31718359 |
T |
 |
| Q |
209 |
tcagtatgatattgaacttcaataactctttggtttggaaatgttgtaaaatttggctgttgcattggctcttgtttcaatcttttgtggttgccgaagt |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
31718360 |
ccagtatgatattgaacttcaataactctttggtttggaaatgttgtaaaatttggctgttgcattggctcttgtttcaatcttttatggttgccgaagt |
31718459 |
T |
 |
| Q |
309 |
taaagaaatatgaa |
322 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
31718460 |
taaagaaatatgaa |
31718473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University