View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10865A_low_127 (Length: 315)
Name: NF10865A_low_127
Description: NF10865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10865A_low_127 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 13 - 315
Target Start/End: Complemental strand, 9985583 - 9985281
Alignment:
| Q |
13 |
aatataatttagggcctatcacaattttcttggcctatatggtagcctacaatataatatggacacaaattgtcacaaaaacttggtcactctagggaaa |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
9985583 |
aatataatttagggcctatcacaattttcttggcctatatggtagcctacaatataatatggacacaaattgtcacaaaaacttggtcactctagagaaa |
9985484 |
T |
|
| Q |
113 |
gacatggaacataaggtatacatgaagtgcataccccatttacatttttgcatgatgcatgaatttcctctcctatagaagatgttatgttaatcccttc |
212 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
9985483 |
gacatggaacataaggtatgcatgaagtgcatactccatttacatttttgcatgatgcatgaacttcctctcctatagaagatgttatgttaatcccttc |
9985384 |
T |
|
| Q |
213 |
aagtataatgtttgtgcaagttatggcttcatcacaatgtaattgaattacatctttagcaatagatgttcctcttatgttgcggaaagttacatcactt |
312 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9985383 |
aagtataatgtttgtgcaagttatgtcttcatcacaatgtaattgaattgcatgtttagcaatagatgttcctcttatgttgcggaaagttacatcactt |
9985284 |
T |
|
| Q |
313 |
act |
315 |
Q |
| |
|
||| |
|
|
| T |
9985283 |
act |
9985281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University